DNA Molecule:
GAAATACCAAGCCAACGTAAGTGTTATACTTTGGATCCAGG
Happy decoding!
Thursday, October 30, 2014
Wednesday, October 22, 2014
The Historical Influence of Thomas Malthus on Darwin's Theory of Natural Selection
Of the list of provided, I believe Thomas Malthus had the most (and most positive) influence on the development of Charles Darwin's theory of Natural Selection. Darwin took interest in Malthus' idea regarding population vs struggle for resources, and then translated it to areas of science in the wild.
Thomas Malthus (1766-1834) was an economist who wrote, "Essay on the Principle of Population." This argued, pointedly, that as the human population grew and resources such as food became more scarce, the weakest portions of the human race would begin to die off.
Thomas Malthus' work most directly affects the points of evolution regarding 1) access to resources and 2) traits adaptive to the changing environment. The idea was, once resources become scarce and people begin to starve and die off, the strongest and most fit will survive to pass on their traits. This positively influenced Charles Darwin's work in that he recognized the animal kingdom populations were forever limited by resources, thus creating constant competition. Because the weakest of any population lose the struggle to survive, it only leaves the "fittest" portions of a population to procreate, thus creating traits in a species adaptive to changing environments.
I think it is possible that Darwin would have reached his theory of natural selection without the introduction of Malthus' population vs resource ideas. Darwin had already gathered his own data on biological variation within a species, he just didn't quite have an explanation for his arguments. I believe that Darwin had a moment of insight or "aha!" when he read Thomas Malthus' essay in 1838 and this sparked the arrival of natural selection.
Even though Darwin had developed and written a summary of his natural selection theory, he hesitated to publish it. Part of this was because of the controversy this posed. His ideas countered religious convictions of the time and would have been met with a lot of resistance. He was not ready to be the center of an argument between science and religion, and so he waited more than two decades to finally publish his theory on natural selection.
resources:
Berkeley on Darwin
Thomas Malfus
Influences on Darwin
Religion vs Science, Darwin's Hesitation
Introduction to Physical Anthropology 2013-2014(text book)
Thomas Malthus (1766-1834) was an economist who wrote, "Essay on the Principle of Population." This argued, pointedly, that as the human population grew and resources such as food became more scarce, the weakest portions of the human race would begin to die off.
Thomas Malthus' work most directly affects the points of evolution regarding 1) access to resources and 2) traits adaptive to the changing environment. The idea was, once resources become scarce and people begin to starve and die off, the strongest and most fit will survive to pass on their traits. This positively influenced Charles Darwin's work in that he recognized the animal kingdom populations were forever limited by resources, thus creating constant competition. Because the weakest of any population lose the struggle to survive, it only leaves the "fittest" portions of a population to procreate, thus creating traits in a species adaptive to changing environments.
I think it is possible that Darwin would have reached his theory of natural selection without the introduction of Malthus' population vs resource ideas. Darwin had already gathered his own data on biological variation within a species, he just didn't quite have an explanation for his arguments. I believe that Darwin had a moment of insight or "aha!" when he read Thomas Malthus' essay in 1838 and this sparked the arrival of natural selection.
Even though Darwin had developed and written a summary of his natural selection theory, he hesitated to publish it. Part of this was because of the controversy this posed. His ideas countered religious convictions of the time and would have been met with a lot of resistance. He was not ready to be the center of an argument between science and religion, and so he waited more than two decades to finally publish his theory on natural selection.
resources:
Berkeley on Darwin
Thomas Malfus
Influences on Darwin
Religion vs Science, Darwin's Hesitation
Introduction to Physical Anthropology 2013-2014(text book)
Subscribe to:
Posts (Atom)