Human Variation & Race

Ultraviolet Radiation, an Environmental Stress

High levels of solar radiation is an environmental stress that can be incredibly detrimental to human survival when there is inadequate adaptation. Ultraviolet (UV) radiation can cause burns of the epidermis, which can cause a mutation of DNA resulting in skin cancer (particularly melanoma). Melanoma is deadly, killing approximately 8,000 people per year in the United States alone. In addition to cancer, the penetration of too much UV radiation into the skin can cause anemia by breaking down folate in the body. Folate is important to humans, and particularly important to pregnant mothers. A lack of folate can cause miscarriages and birth defects.

Short-term Adaptation

I don't really think there is a short term adaptation in response to UV radiation. The human body is not able to quickly adapt to the sunlight, it takes time for a skin tan to form. This makes overexposure to sunlight dangerous. What may be something close to short-term adaptation is the skin beginning to feel hot when exposed to too much sunlight. I can always feel when my skin is starting to burn, and common sense kicks in and says, "Get out of the sun!"

Facultative Adaptation

In response to UV rays, humans, over time, have adapted by way of facultative adaptation. Facultative gene action monitors the environment (in this case, levels of UV rays) and adjusts the phenotypes of humans accordingly. When there are high levels of solar radiation present (like during summer) specialized cells called melanocytes produce melanin in response. Melanin acts as a shield against the sun rays, and results in a darker phenotype (suntan). Over thousands of years, humans have adapted to the level of solar radiation in different areas of the world. Those in areas closest to the equator (i.e. Africa and Australia) face particularly high levels of ultraviolet radiation. Because of this, humans with the most effective facultative adaption by way of creating melanin have survived over time and passed those strong genes on. Skin color goes hand in hand with this, as melanin is a pigment in determining skin color. 

A person's production of melanin is a developmental adaptation.

Developmental Adaptation

There are two types of melanin: pheomelanin and eumelanin. Pheomelanin is a lighter form, eumelanin being dark brown-black. Individuals that produce more eumelanin than pheomelanin are better adapted to living in a solar radiation rich environment and will have a much darker complexion than someone who produces primarily pheomelanin. Because of this, initial populations closest to the equator (roughly within 20 degrees) were dark skinned. As populations radiated from the equator, their levels of melanin altered in order to be more suited to the environment. Populations far north of the equator have much fairer skin (high levels of pheomelanin) and are more likely to burn and peel than they are to tan. Because some UV absorption is important to the human body (needed for the production of vitamin D) populations that live in areas with less solar radiation need to produce lower levels of melanin. Vitamin D is vital in the body's ability to process calcium. If a person produces too much melanin in an area with little sunlight, they face the possibility of developing diseases like rickets and osteoporosis. Because of this, humans in these areas have adapted to a lower melanin production. However, since these same individuals can face overexposure to the sun due to lowered levels of melanin, they are more apt to develop skin cancer.

Cultural Adaption

A cultural adaption to the dangers of UV radiation is the development and use of sunscreen, protective clothing, and shades/umbrellas. Because, over time, populations have spread out across the globe, there are now people of all skin-colors scattered in all areas of the world. Initially, our ancestors utilized shelter and clothing to protect their bodies from the harmful (and hot!) sun rays. With technological advances came the production of sunscreen, which is also better suited to an overall "outdoorsy" culture. Overall, humans enjoy outdoor sports, beaches, hiking, etc.. In order to compensate for low production levels of melanin in some of the population, we needed an artificial way to protect skin when populations began migrating and spreading out to all areas of the globe. Sunscreen has allowed people with all levels of pigmentation to travel, mingle, and migrate.

Benefits

I think there are definitely future benefits to studying human variation from this perspective across environmental clines. I also think that the information we gather in this area has helped us in at least one way: sun screen. We understand that skin less able to adapt to high levels of ultraviolet radiation need more protection than their body is capable of producing. Scientists developing alternative methods of artificially shielding skin from harmful rays have helped to save lives by preventing malignant skin cancers. In addition to this, studying human variation from this angle could help us in the future treatment and prevention of diseases like rickets and anemia. For example, in studying a lack of rickets in people with light skin, scientists and doctors might better understand the level of sunlight needed to avoid the development of this disease.

A Better Way to Understand Variation

I think race should be used only to categorize groups of humans with similar adaptations to similar environments. By classifying race in this manner, we can see how humans have adapted over the years and possibly predict future adaptations in response to particular environmental stresses (like sunlight). By studying the influence that environments have on human populations over time, we could start to detect patterns of adaptations. Certain human adaptations (i.e. skin color) can be permanent. Other adaptations are only present while exposed to a particular environmental stress, as evident by humans ability to tan during the summer due to prolonged exposure to the sun. Because the human race's ability to adapt to environmental stresses is present in all humans, it is apparent that we are connected on a more basic (genetic) level than we are by an outward difference in phenotype. Studying the environmental influences and human response to those environments (our adaptations) can provide evidence that groups of people are not entirely different species. While we have a long way to go before we can solve the problem of racism, studying human phenotype differences in this manner (based on adaptation to differing environments) could help to advance us culturally. It could help us to become more accepting of one another rather than passing judgements based on someones skin tone.

Facing the Barriers, a Language Blog Post

Facing the Barriers

        

         During the Thanksgiving holiday, I engaged my partner (we will call her "A") in an interesting game of language barriers. Through parts 1 and 2 of our game, I saw power shifts and struggles to communicate on both ends. 

Part 1, the Silent Treatment

In the first part of my conversation with A, I restricted my communication to body language, hand gestures, and nodding/shaking my head. I found it very difficult to communicate this way and noticed that A had a lot of trouble interpreting me. Because it was so difficult to interpret what I was attempting to say, A ended up resorting to only speaking in terms of things I could answer in agreement or disagreement (nodding or shaking my head). This portion of our game seemed to drag on and really got us no where.

During the course of our conversation, A initiated at least 98% of the communication and topic changes. The only power I really had to initiate any changes was to use some gesture of affection (i.e. a hug). Because of my lack of ability to adequately communicate with A, and her resorting to yes/no questions, I think I held a good portion of the power in our conversation. My conversation limits really hindered her communication attempts with me and she was forced to accommodate my lowered language abilities. On the same token, I felt very "left behind" in my inability to change topics or initiate any particular conversation. In this aspect, A also held power in her own way and there was definite frustration on her end as well. 

Imagining that A and I represented separate cultures in this exercise, I would say that she definitely held an advantage in communicating any complex ideas. While she would be able to adequately explain herself, and receive equally understood responses from fellow members of her culture, I would find it difficult to relay any type of complicated information. I can only liken my communication abilities in this game to "infant" or "toddler" abilities. In the scenario of cultures, I can imagine that a speaking culture would definitely look on a non-speaking culture as being less-than or infantile. The closest "modern situation" that might mirror this (that comes to mind) is the communication barriers between Deaf and hearing cultures (worldwide). For a long time, members of the Deaf community were considered "less than"** due to their inability to communicate through hearing and speaking. Even today, Deaf people sometimes face discrimination and frustration in their every day lives. 

** I do not personally feel that any member of the Deaf community is less than. The above statement is made based on historical events involving Deaf Culture. 

Part 2, the Monotone Treatment

For the next part of this game, I had to imagine that I was encased, from head to toe, in clear glue. Or that I had fallen victim to a Harry Potter spell and could only move my lips and eye balls. It was, in no lesser word, constricting. In all honesty, A found this rather amusing initially and she did not have any problems understanding me. The only confusion there really was for her was whether or not I was being sincere. 

I think this experiment actually says a lot about how much our language abilities rely on non-manual markers like raised/lowered eyebrows, nodding, even a slight tilt of the head when asking questions. In normal, day-to-day conversations, these gestures and bodily articulations come naturally and they allow the people around us to more accurately interpret what we are saying. Because I was going against instinct and not providing A with any gestures, facial cues, or voice inflection, she was less capable of interpreting me. Body language allows us to read a person's sincerity, interest in the conversation, and emotions. I was not providing A with any of these things. 

I think body language provides a huge advantage to a person's ability to survive, obtain resources, and reproduce successfully. Without the ability to read body language, we wouldn't (sometimes) know when someone poses a threat and therefore know when to fight or flee. Without body language, it would also be difficult for people to form genuine connections to each other and (eventually) to mate and produce offspring. It helps us to identify whether or not someone is actually interested in seeing us as a potential mate. Body language also helps us to obtain resources in that we may be able to recognize when someone can or cannot meet our needs and whether or not we might key in on their body language and use it to manipulate (maliciously or benevolently) them into providing resources. 

There are definitely people that are worse at reading body language than others. These people are sometimes easily identified by their inappropriate responses to others. While I think it is hardly ever beneficial to be unable to read someones body language, I do think a scenario in which it COULD be beneficial is a job interview. If the interviewer is unable to read the body language of a particularly nervous person, the interviewee may stand a better chance in the interview. Because, any nervous gestures do not necessarily mean that the person would be incapable of handling the job at hand. Of course, this could be a double edged sword because body language can sometimes convey lying. I think everybody has a "tell," or a physically noticeable gesture or facial cue when they are lying and this is definitely beneficial. 

        Overall, A and I both prefer being able to communicate on equal, understandable ground. While we found this exercise interesting, we both learned not to take our language abilities for granted. I also learned that it must have taken a long time and a lot of hard work for humans to develop an adequate form of language in any culture. 

Breaking the Jaw: the Deconstruction of the Piltdown Hoax

In 1912, Charles Dawson (an amateur archaeologist) conducted at dig at Piltdown in England. He had found what he claimed to be the fossilized remains of a human skull. Along with Arthur Woodward (geologist) and Father Pierre Teilhard de Chardin (paleontologist), Dawson continued his dig at Piltdown. Over a summer, they made what was deemed "astonishing finds." There, Charles Dawson found a jawbone he asserted belonged to the ancient piece of human skull he had previously discovered.

This jawbone did not look to be human, but something closer to an ape in structure. What did imply human characteristics was the shape of the teeth. They were ground into the shape of human molars, as though from grinding and crushing food over time. This find was incredible, at the time, and caused a lot of excitement in the field of science. It was viewed as the "holy grail" of paleontology, and seemed to express some kind of evolutionary connection between apes and humans. In England, it was widely celebrated by the scientific community because (finally) there was evidence that England, too, had ancient human remains. What was particularly important to England was the fact that these remains (dubbed the "Piltdown Man") might even be the oldest human remains of all.

With affirmation from England's leading anatomist, Arthur Keith, the finding of the jaw and skull bones seemed to support the theory that the development of large brains came before the development of upright walking in human evolution. This was incredibly important to the field of science and, in particular, to the field of human evolution. The group continued to find fossilized remains until the death of Charles Dawson in 1916, and people in the scientific community (even skeptics) did not challenge their findings.

Evidence contradicting the findings of Piltdown Man began appearing in the 1920's when, in places like Africa and Asia, a number of ancient human remains began to be discovered. The contradicting evidence came in the fact that the newly discovered human remains were not as old as Pildown Man, but were far less human. At that time there was insufficient technology to distinguish whether the remains of Piltdown Man were just a weird phenomenon in human evolution or entirely false.

It was until 1949 that technology allowed for a new method of dating the remains by measuring the fluorine content of the fossils. This method of chemical analysis had been devised in 1939 by Kenneth Oakley. Fossils absorb fluorine from the soil and water around them, so fossils found in the same area should be around the same age.  10 years after its discovery, Kenneth Oakley was able to use the measurement of fluorine to reveal that the fossilized remains that were significantly younger than previously asserted(50,000 vs. 500,000). This furthered confusion in the scientific community because other remains of the same ages found in other areas made the Piltdown Man appear to be a throwback. Then after WWII, in 1953, a larger-scaled study of the Piltdown Man was underway. This study revealed that the Piltdown Man was, in fact, a hoax.

The coloring of the fossilized jawbone was false, having been stained to appear older, and pieces of the bone had been cut off after fossilization. In addition to this, the teeth had been filed down to resemble human molars. The jawbone actually belonged to a female orangutan less than a hundred years old, but pieces of the jaw that would have indicated this were broken off. By 1959, carbon-14 dating was available and it was then revealed that the skullcap "fossils" were not even more than 1,000 years old and were really just old bones.

This evidence was very important to the field of evolution because it is physical evidence, rather than purely circumstantial. It shocked scientists that this could happen, but it brought to light that scientists are human, subject to pride and self-interest, and can therefore lie to further careers (as seen in the particular case of Piltdown). It had previously been thought that scientists would not provide false science, but now scientists are more aware that this can happen and are therefore more careful in the analysis of scientific evidence. Unfortunately, this also gives "ammunition" to groups that are against science, and specifically against evolution. It can be asserted, now, that scientists lie and therefore all scientific evidence cannot be taken seriously.

While it would be ideal to remove the human qualities that lead to scientific falsities like the Piltdown Man, removing the human nature aspect of scientists would also remove the positive parts of human nature. The positive aspects of human nature allow for things like creativity, perseverance, and curiosity. Without these things, I think there would hardly be any advancement in science at all.

From the Piltdown Man hoax, a lot can be learned in regards to using verified sources. I definitely understand the value in not taking everything at face-value and how important it is to rely on sources with a lot of credibility and merit. Sometimes, a little dose of skepticism could even be a good thing. Perhaps if the scientists in England in the early 1900s had taken their own skepticism more seriously, they would have been more creative and persistent in their evaluation of the Piltdown Man remains and therefore would have revealed it as a hoax sooner than ~40 years after the initial findings. 

Sources:
Piltdown Man is revealed as fake 1953, PBS

Piltdown Hoax, pt 1

Piltdown Hoax, pt 2

Dietary Traits Among Primates

Lemurs(Prosimians/Strepsirhini) 

Lemurs are primates with a very restricted range, and are only found on the tropical island of Madagascar. They are arboreal, living in the treetops of the Madagascar rainforests along the north-south axis on the east coast of the island. The forests are tropical in climate: warm and humid. The east side of the island gets, on average, 3.5 meters of rainfall each year and is home to thousands of species of animals, insects, and plant life (including a vast array of trees for these lemurs to call "home").

Because Lemurs are tree-dwellers their diet consists primarily of fruits and seeds found in the tops of trees. However, some families of Lemurs (like the Aye Aye) prey on frogs, insects, eggs and newly hatched birds (also found in tree tops).

Since Lemurs are arbhoreal, it makes sense that, over time, they have adapted to any and all food sources available to them. This adaptation is expressed in their omnivorous dietary trait.

Aye Aye (lemur) eating from a bird's egg. 

Spider Monkey (New World Monkey/Platyrrhini) 

The spider monkey, also a primate, is found in the tree tops of the tropical rain forests in Central and South America. They even reside as far north as Mexico. There, the climate is generally hot and humid through out the year, with an average temperature of 80 degrees fahrenheit. In the rain forests of Central and South America, there is no real "dry season" with up to 180 inches of rain each year. The trees of the rain forests range in size and are densely packed, providing the perfect home for the spider monkey.

Like other arboreal primates, the spider monkey's diet is varied. They eat nuts, eggs, spiders, fruits and leaves found high in the trees of rainforests across Central and South America.

Like the lemur, they have adapted to a variety of foods, eating what is available to them in their surrounding environment and providing them with an abundance of food choices.

Spider monkey eating fruit.

Baboon (Old World Monkey/Cercopithecidae) 

African grassland, sub-saharan.

The baboon is found in the sub-saharan African savannahs. Their habitat differs from other primates in that the trees are far more sparse than the densely packed trees of rain forests. Baboons spend most of their time roaming the ground in the grasslands of Africa. Also unlike rainforests, the climate in the sub-saharans is arid and dry.

The baboon is a hunter as well as a forager, sometimes feeding on other primates and the young of larger mammals such as antelopes. They are even known to hunt flamingos. While foraging, they will eat grass, seeds, roots, bark and fruit from trees. Baboons are also opportunistic in their diet and will eat the crops on farms, becoming a pest for African farmers.

Baboon feeding on an antelope in a tree top. 

Similarily to other primates, baboons have adapted their diets to meet the opportunities found in their environment. Being omnivorous and opportunistic provide them a greater chance of finding food all across the sub-saharan terrain.









Gibbon (Lesser Ape/Hylobatidae)

Jungle in South-East Asia

Gibbons can be found in the tropical jungles of South-east Asia, China, and the surrounding islands. They are arboreal, rarely coming down from the tops of trees. The trees in these jungles are abundant and densely packed, providing a great enviroment for gibbons, who can swing effortlessly from one tree to the next.

Mother and baby gibbons eating. 

Gibbons thrive, primarily, on the abundant fruits found in the trees where they dwell, favoring figs above all others. Though fruit foraging makes up aproximately 75% of the gibbons food source, they are omnivorous (like other primates) and will sometimes supplement their diet with leaves, bark, flowers, birds and bird eggs found in the tree tops.

Again, they have adapted to the food sources available to them and have developed a very generalized diet.





Chimpanzee (Great Ape/Hominidae) 

Central African rainforest.

Chimpanzees live in the tropical rainforests of central Africa. Though it recieves less rainfall than most (only 68-73 inches annually), the rainforests of central Africa are still rich in bio-diversity in regards to plant, insect, and mammalian life. Similar to other forests, trees account for aproximately 70% of the plant life (600 different species), providing a great home for the arboreal and terrestrial chimpanzee. The forests in central Africa are home to the tallest species of rain forest tree, the Kapok. Also like other rainforests, the trees are incredibly densely packed and it can take up to 10 minutes for rain to hit the forest floor.

Chimpanzee feeding on fruit.

The chimpanzee is also an omnivorous primate. Though they feed primarily on fruits, their diet consists of up to 80 different plant foods including blossoms and leaves, and they can sometimes be found eating other mammals. Occassionally, a chimpanzee will eat an antelope or goat, but more frequently they might feed on other primates such as young baboons. Because the chimpanzee is found in such densely packed vegetation with abundant bio-diversity, they have not been forced to adapt to any single food source, but have the ability and desire to feed on a wide-array of sources.

Mother and baby chimpanzee eating. 

While these five primates have adapted to finding food in their separate environments, they have not developed a particularly specialized diet. Each primate lives in an environment that is rich in bio-diversity, providing an abundant source of foods and allowing them to adapt to eating a wide variety in their omnivorous diets. Evolutionarily speaking, this provides these primates with an advantage when resources become scarce. Because their diets are so generalized, when a food source runs out they still have options.   

Rainforests of the world.

Sources: 

http://www.pbs.org/wnet/africa/explore/southern/southern_animals_lo.html

http://animals.nationalgeographic.com/animals/mammals/gibbon/

http://animals.nationalgeographic.com/animals/mammals/spider-monkey/

http://www.outtoafrica.nl/animals/engchimpanzee.html

http://interesting-africa-facts.com/Africa-Landforms/African-Rainforest-Facts.html

Homologous and Analogous Traits in Anthropology

Homologous Traits in Whales and Horses: 

Humpback Whale 

"Homologous traits are those shared between two different species because their common ancestor possessed the trait and passed it on, even though they appear to the eye to be different structures. This means that this shared trait indicates a genetic relationship exists between the species. Differences in those traits are due to differences in the environment, resulting in different functions and evolutionary selection pressures. The process that produces these different but genetically-related traits is called divergent evolution."

Two species with a homologous trait are whales ande horses. Horses, from the family Equidae, are four-legged land mammals in a variety of sizes depending upon the breed. Whales, or porpoises, in the family Cetecea, are large (generally speaking) ocean-dwelling mammals. Both the horse and the whale have similar forelimbs, containing the ulna, radius, humerus, and phalanges. 

 In the horse, the humerus, radius, and ulna differ in size from that of the whale. In addition to size, the carpals, metacarpals, and phalanges are developed into one long toe (ending in a hard hoof) with the rest of their phalanges being vestigial or non-existent. The humerus and radius are elongated to accomodate long distance coverage of land. 

In whales, the ulna, radius, and humerus are more compact with five separate phalanges. These bones are not visible from the outside and each flipper appears as a broad, flat limb used for navigating through water. 

Though the general "make-up" of the forelimbs of whales and horses is the same, their limbs differ tdue to their very different environments. Because whales live in large bodies of water, they need limbs that will propel them through water efficiently for great distances. And because horses live on land and were once considered prey, they needed to develop long, lean, sturdy legs to cover long distances quickly. 

The common ancestor of these two vastly different species were early vertebrates. In recent years, fossils and research have shown tha tthe forelimb development in vertebrates is controlled by only a few genes. According to this research, mutations in the genes of these early vertebrates led to the limb development of all other vertebrates that came after. Because of this, all vertebrates have nearly the same number and structure of bones, with small genetic differences leading to developmental variety (demonstrated by the differences and similarites of horses and whales). 

Wild horse taking a mud bath.

Analogous Traits in Monarch Butterflies and Geese:

"Analogous traits, on the other hand, are not the result of a common genetic history, but are due to a common environmental pressure that caused both species to develop a similar adaptation to that stress. The mechanism that produces this type of matching trait is called convergent evolution. It indicates a simlar evolutionary environmental stress, not an evolutionary genetic relationship."

Monarch Butterfly

Two species with an analogous relationship are monarch butterflies and Canadian geese. The monarch butterfly is a milkweed butterfly found in the Nymphalidae family and its orange and black pattered wings are distint and familar throughout North America. The monarch has a wing span of approximately 9-10cm, making it incredibly small in comparison to the Canadian goose. The goose can have a wing span any where from 127cm-185cm and is found in the Anatidae family.  

While they are very different, they have one thing in common: wings. The wings of both the goose and butterfly are pairs of specialized appendages that enable them to maneuver through the world airborne. Both the butterfly and the goose can fall prey to many predators in the animal kingdom. Because of this, it was important (for survival) to develop a trait for escape. For both the goose and the butterfly, this evolutionary development came in the form of wings. This commonality creates an analogous trait between the two entirely different species.

Canadian Goose

This analogous trait was not present in the common ancestor of the Canadian goose and monarch butterfly. We know this because butterflies evolved from an arthropod (insect) without wings and the goose (and other birds) evolved from lizards that were also wingless. In addition to this, the appendages of these separate species are made entirely differently. The wing of a bird is really a forelimb made of bone and muscle. The bones of the forelimb are structured the same as the whale. The butterfly's wings are made of a scaffolding of veins and tiny scales. Also, the goose (like all other vertebrates) has a skeletal system, developed brains, and a central nervous system--insects do not. Because of these differences, scientists know that these similar structures, the wings, are products of convergent evoloution rather than something inherited from a common ancestor. The link between these two species is entirely superficial. 

Sources: 

Introduction to Physical Anthropology, 2013-2014 edition

http://www.hwdsb.on.ca/hillpark/Departments/Science/Watts/SBI3U/Assigned_Work/Evolution/Homologous_and_Analogous_Vestigial_and_Competition.pdf

http://evolution.berkeley.edu/evolibrary/article/0_0_0/eyes_04

http://bioweb.cs.earlham.edu/9-12/evolution/HTML/live.html

Protein Synthesis, Week #2

DNA Molecule:

GAAATACCAAGCCAACGTAAGTGTTATACTTTGGATCCAGG


Happy decoding!

The Historical Influence of Thomas Malthus on Darwin's Theory of Natural Selection

   Of the list of provided, I believe Thomas Malthus had the most (and most positive) influence on the development of Charles Darwin's theory of Natural Selection. Darwin took interest in Malthus' idea regarding population vs struggle for resources, and then translated it to areas of science in the wild.
   Thomas Malthus (1766-1834) was an economist who wrote, "Essay on the Principle of Population." This argued, pointedly, that as the human population grew and resources such as food became more scarce, the weakest portions of the human race would begin to die off.
   Thomas Malthus' work most directly affects the points of evolution regarding 1) access to resources and 2) traits adaptive to the changing environment. The idea was, once resources become scarce and people begin to starve and die off, the strongest and most fit will survive to pass on their traits. This positively influenced Charles Darwin's work in that he recognized the animal kingdom populations were forever limited by resources, thus creating constant competition. Because the weakest of any population lose the struggle to survive, it only leaves the "fittest" portions of a population to procreate, thus creating traits in a species adaptive to changing environments.
   I think it is possible that Darwin would have reached his theory of natural selection without the introduction of Malthus' population vs resource ideas. Darwin had already gathered his own data on biological variation within a species, he just didn't quite have an explanation for his arguments. I believe that Darwin had a moment of insight or "aha!" when he read Thomas Malthus' essay in 1838 and this sparked the arrival of natural selection.
   Even though Darwin had developed and written a summary of his natural selection theory, he hesitated to publish it. Part of this was because of the controversy this posed. His ideas countered religious convictions of the time and would have been met with a lot of resistance. He was not ready to be the center of an argument between science and religion, and so he waited more than two decades to finally publish his theory on natural selection. 

resources: 
Berkeley on Darwin
Thomas Malfus 
Influences on Darwin 
Religion vs Science, Darwin's Hesitation
Introduction to Physical Anthropology 2013-2014(text book)