Tuesday, November 18, 2014

Breaking the Jaw: the Deconstruction of the Piltdown Hoax



In 1912, Charles Dawson (an amateur archaeologist) conducted at dig at Piltdown in England. He had found what he claimed to be the fossilized remains of a human skull. Along with Arthur Woodward (geologist) and Father Pierre Teilhard de Chardin (paleontologist), Dawson continued his dig at Piltdown. Over a summer, they made what was deemed "astonishing finds." There, Charles Dawson found a jawbone he asserted belonged to the ancient piece of human skull he had previously discovered.

This jawbone did not look to be human, but something closer to an ape in structure. What did imply human characteristics was the shape of the teeth. They were ground into the shape of human molars, as though from grinding and crushing food over time. This find was incredible, at the time, and caused a lot of excitement in the field of science. It was viewed as the "holy grail" of paleontology, and seemed to express some kind of evolutionary connection between apes and humans. In England, it was widely celebrated by the scientific community because (finally) there was evidence that England, too, had ancient human remains. What was particularly important to England was the fact that these remains (dubbed the "Piltdown Man") might even be the oldest human remains of all.

With affirmation from England's leading anatomist, Arthur Keith, the finding of the jaw and skull bones seemed to support the theory that the development of large brains came before the development of upright walking in human evolution. This was incredibly important to the field of science and, in particular, to the field of human evolution. The group continued to find fossilized remains until the death of Charles Dawson in 1916, and people in the scientific community (even skeptics) did not challenge their findings.

Evidence contradicting the findings of Piltdown Man began appearing in the 1920's when, in places like Africa and Asia, a number of ancient human remains began to be discovered. The contradicting evidence came in the fact that the newly discovered human remains were not as old as Pildown Man, but were far less human. At that time there was insufficient technology to distinguish whether the remains of Piltdown Man were just a weird phenomenon in human evolution or entirely false.

It was until 1949 that technology allowed for a new method of dating the remains by measuring the fluorine content of the fossils. This method of chemical analysis had been devised in 1939 by Kenneth Oakley. Fossils absorb fluorine from the soil and water around them, so fossils found in the same area should be around the same age.  10 years after its discovery, Kenneth Oakley was able to use the measurement of fluorine to reveal that the fossilized remains that were significantly younger than previously asserted(50,000 vs. 500,000). This furthered confusion in the scientific community because other remains of the same ages found in other areas made the Piltdown Man appear to be a throwback. Then after WWII, in 1953, a larger-scaled study of the Piltdown Man was underway. This study revealed that the Piltdown Man was, in fact, a hoax.

The coloring of the fossilized jawbone was false, having been stained to appear older, and pieces of the bone had been cut off after fossilization. In addition to this, the teeth had been filed down to resemble human molars. The jawbone actually belonged to a female orangutan less than a hundred years old, but pieces of the jaw that would have indicated this were broken off. By 1959, carbon-14 dating was available and it was then revealed that the skullcap "fossils" were not even more than 1,000 years old and were really just old bones.

This evidence was very important to the field of evolution because it is physical evidence, rather than purely circumstantial. It shocked scientists that this could happen, but it brought to light that scientists are human, subject to pride and self-interest, and can therefore lie to further careers (as seen in the particular case of Piltdown). It had previously been thought that scientists would not provide false science, but now scientists are more aware that this can happen and are therefore more careful in the analysis of scientific evidence. Unfortunately, this also gives "ammunition" to groups that are against science, and specifically against evolution. It can be asserted, now, that scientists lie and therefore all scientific evidence cannot be taken seriously.

While it would be ideal to remove the human qualities that lead to scientific falsities like the Piltdown Man, removing the human nature aspect of scientists would also remove the positive parts of human nature. The positive aspects of human nature allow for things like creativity, perseverance, and curiosity. Without these things, I think there would hardly be any advancement in science at all.

From the Piltdown Man hoax, a lot can be learned in regards to using verified sources. I definitely understand the value in not taking everything at face-value and how important it is to rely on sources with a lot of credibility and merit. Sometimes, a little dose of skepticism could even be a good thing. Perhaps if the scientists in England in the early 1900s had taken their own skepticism more seriously, they would have been more creative and persistent in their evaluation of the Piltdown Man remains and therefore would have revealed it as a hoax sooner than ~40 years after the initial findings. 

Sources:
Piltdown Man is revealed as fake 1953, PBS

Piltdown Hoax, pt 1

Piltdown Hoax, pt 2








Wednesday, November 12, 2014

Dietary Traits Among Primates

Lemurs(Prosimians/Strepsirhini) 

Lemurs are primates with a very restricted range, and are only found on the tropical island of Madagascar. They are arboreal, living in the treetops of the Madagascar rainforests along the north-south axis on the east coast of the island. The forests are tropical in climate: warm and humid. The east side of the island gets, on average, 3.5 meters of rainfall each year and is home to thousands of species of animals, insects, and plant life (including a vast array of trees for these lemurs to call "home").

Because Lemurs are tree-dwellers their diet consists primarily of fruits and seeds found in the tops of trees. However, some families of Lemurs (like the Aye Aye) prey on frogs, insects, eggs and newly hatched birds (also found in tree tops).

Since Lemurs are arbhoreal, it makes sense that, over time, they have adapted to any and all food sources available to them. This adaptation is expressed in their omnivorous dietary trait.
Aye Aye (lemur) eating from a bird's egg. 


Spider Monkey (New World Monkey/Platyrrhini) 

The spider monkey, also a primate, is found in the tree tops of the tropical rain forests in Central and South America. They even reside as far north as Mexico. There, the climate is generally hot and humid through out the year, with an average temperature of 80 degrees fahrenheit. In the rain forests of Central and South America, there is no real "dry season" with up to 180 inches of rain each year. The trees of the rain forests range in size and are densely packed, providing the perfect home for the spider monkey.

Like other arboreal primates, the spider monkey's diet is varied. They eat nuts, eggs, spiders, fruits and leaves found high in the trees of rainforests across Central and South America.

Like the lemur, they have adapted to a variety of foods, eating what is available to them in their surrounding environment and providing them with an abundance of food choices.
Spider monkey eating fruit.

Baboon (Old World Monkey/Cercopithecidae) 


African grassland, sub-saharan.
The baboon is found in the sub-saharan African savannahs. Their habitat differs from other primates in that the trees are far more sparse than the densely packed trees of rain forests. Baboons spend most of their time roaming the ground in the grasslands of Africa. Also unlike rainforests, the climate in the sub-saharans is arid and dry.

The baboon is a hunter as well as a forager, sometimes feeding on other primates and the young of larger mammals such as antelopes. They are even known to hunt flamingos. While foraging, they will eat grass, seeds, roots, bark and fruit from trees. Baboons are also opportunistic in their diet and will eat the crops on farms, becoming a pest for African farmers.
Baboon feeding on an antelope in a tree top. 

Similarily to other primates, baboons have adapted their diets to meet the opportunities found in their environment. Being omnivorous and opportunistic provide them a greater chance of finding food all across the sub-saharan terrain.









Gibbon (Lesser Ape/Hylobatidae)

Jungle in South-East Asia
Gibbons can be found in the tropical jungles of South-east Asia, China, and the surrounding islands. They are arboreal, rarely coming down from the tops of trees. The trees in these jungles are abundant and densely packed, providing a great enviroment for gibbons, who can swing effortlessly from one tree to the next.





Mother and baby gibbons eating. 
Gibbons thrive, primarily, on the abundant fruits found in the trees where they dwell, favoring figs above all others. Though fruit foraging makes up aproximately 75% of the gibbons food source, they are omnivorous (like other primates) and will sometimes supplement their diet with leaves, bark, flowers, birds and bird eggs found in the tree tops.

Again, they have adapted to the food sources available to them and have developed a very generalized diet.





Chimpanzee (Great Ape/Hominidae) 

Central African rainforest.

Chimpanzees live in the tropical rainforests of central Africa. Though it recieves less rainfall than most (only 68-73 inches annually), the rainforests of central Africa are still rich in bio-diversity in regards to plant, insect, and mammalian life. Similar to other forests, trees account for aproximately 70% of the plant life (600 different species), providing a great home for the arboreal and terrestrial chimpanzee. The forests in central Africa are home to the tallest species of rain forest tree, the Kapok. Also like other rainforests, the trees are incredibly densely packed and it can take up to 10 minutes for rain to hit the forest floor.

Chimpanzee feeding on fruit.


The chimpanzee is also an omnivorous primate. Though they feed primarily on fruits, their diet consists of up to 80 different plant foods including blossoms and leaves, and they can sometimes be found eating other mammals. Occassionally, a chimpanzee will eat an antelope or goat, but more frequently they might feed on other primates such as young baboons. Because the chimpanzee is found in such densely packed vegetation with abundant bio-diversity, they have not been forced to adapt to any single food source, but have the ability and desire to feed on a wide-array of sources.





Mother and baby chimpanzee eating. 




While these five primates have adapted to finding food in their separate environments, they have not developed a particularly specialized diet. Each primate lives in an environment that is rich in bio-diversity, providing an abundant source of foods and allowing them to adapt to eating a wide variety in their omnivorous diets. Evolutionarily speaking, this provides these primates with an advantage when resources become scarce. Because their diets are so generalized, when a food source runs out they still have options.   


Rainforests of the world.



Sources: 




Thursday, November 6, 2014

Homologous and Analogous Traits in Anthropology

Homologous Traits in Whales and Horses: 

Humpback Whale 

"Homologous traits are those shared between two different species because their common ancestor possessed the trait and passed it on, even though they appear to the eye to be different structures. This means that this shared trait indicates a genetic relationship exists between the species. Differences in those traits are due to differences in the environment, resulting in different functions and evolutionary selection pressures. The process that produces these different but genetically-related traits is called divergent evolution."

Two species with a homologous trait are whales ande horses. Horses, from the family Equidae, are four-legged land mammals in a variety of sizes depending upon the breed. Whales, or porpoises, in the family Cetecea, are large (generally speaking) ocean-dwelling mammals. Both the horse and the whale have similar forelimbs, containing the ulna, radius, humerus, and phalanges. 

 In the horse, the humerus, radius, and ulna differ in size from that of the whale. In addition to size, the carpals, metacarpals, and phalanges are developed into one long toe (ending in a hard hoof) with the rest of their phalanges being vestigial or non-existent. The humerus and radius are elongated to accomodate long distance coverage of land. 

In whales, the ulna, radius, and humerus are more compact with five separate phalanges. These bones are not visible from the outside and each flipper appears as a broad, flat limb used for navigating through water. 

Though the general "make-up" of the forelimbs of whales and horses is the same, their limbs differ tdue to their very different environments. Because whales live in large bodies of water, they need limbs that will propel them through water efficiently for great distances. And because horses live on land and were once considered prey, they needed to develop long, lean, sturdy legs to cover long distances quickly. 

The common ancestor of these two vastly different species were early vertebrates. In recent years, fossils and research have shown tha tthe forelimb development in vertebrates is controlled by only a few genes. According to this research, mutations in the genes of these early vertebrates led to the limb development of all other vertebrates that came after. Because of this, all vertebrates have nearly the same number and structure of bones, with small genetic differences leading to developmental variety (demonstrated by the differences and similarites of horses and whales). 


Wild horse taking a mud bath.



Analogous Traits in Monarch Butterflies and Geese:

"Analogous traits, on the other hand, are not the result of a common genetic history, but are due to a common environmental pressure that caused both species to develop a similar adaptation to that stress. The mechanism that produces this type of matching trait is called convergent evolution. It indicates a simlar evolutionary environmental stress, not an evolutionary genetic relationship."

Monarch Butterfly
Two species with an analogous relationship are monarch butterflies and Canadian geese. The monarch butterfly is a milkweed butterfly found in the Nymphalidae family and its orange and black pattered wings are distint and familar throughout North America. The monarch has a wing span of approximately 9-10cm, making it incredibly small in comparison to the Canadian goose. The goose can have a wing span any where from 127cm-185cm and is found in the Anatidae family.  

While they are very different, they have one thing in common: wings. The wings of both the goose and butterfly are pairs of specialized appendages that enable them to maneuver through the world airborne. Both the butterfly and the goose can fall prey to many predators in the animal kingdom. Because of this, it was important (for survival) to develop a trait for escape. For both the goose and the butterfly, this evolutionary development came in the form of wings. This commonality creates an analogous trait between the two entirely different species.
Canadian Goose

This analogous trait was not present in the common ancestor of the Canadian goose and monarch butterfly. We know this because butterflies evolved from an arthropod (insect) without wings and the goose (and other birds) evolved from lizards that were also wingless. In addition to this, the appendages of these separate species are made entirely differently. The wing of a bird is really a forelimb made of bone and muscle. The bones of the forelimb are structured the same as the whale. The butterfly's wings are made of a scaffolding of veins and tiny scales. Also, the goose (like all other vertebrates) has a skeletal system, developed brains, and a central nervous system--insects do not. Because of these differences, scientists know that these similar structures, the wings, are products of convergent evoloution rather than something inherited from a common ancestor. The link between these two species is entirely superficial. 


Sources: 




Thursday, October 30, 2014

Protein Synthesis, Week #2













DNA Molecule:

GAAATACCAAGCCAACGTAAGTGTTATACTTTGGATCCAGG


Happy decoding!

Wednesday, October 22, 2014

The Historical Influence of Thomas Malthus on Darwin's Theory of Natural Selection

   Of the list of provided, I believe Thomas Malthus had the most (and most positive) influence on the development of Charles Darwin's theory of Natural Selection. Darwin took interest in Malthus' idea regarding population vs struggle for resources, and then translated it to areas of science in the wild.
   Thomas Malthus (1766-1834) was an economist who wrote, "Essay on the Principle of Population." This argued, pointedly, that as the human population grew and resources such as food became more scarce, the weakest portions of the human race would begin to die off.
   Thomas Malthus' work most directly affects the points of evolution regarding 1) access to resources and 2) traits adaptive to the changing environment. The idea was, once resources become scarce and people begin to starve and die off, the strongest and most fit will survive to pass on their traits. This positively influenced Charles Darwin's work in that he recognized the animal kingdom populations were forever limited by resources, thus creating constant competition. Because the weakest of any population lose the struggle to survive, it only leaves the "fittest" portions of a population to procreate, thus creating traits in a species adaptive to changing environments.
   I think it is possible that Darwin would have reached his theory of natural selection without the introduction of Malthus' population vs resource ideas. Darwin had already gathered his own data on biological variation within a species, he just didn't quite have an explanation for his arguments. I believe that Darwin had a moment of insight or "aha!" when he read Thomas Malthus' essay in 1838 and this sparked the arrival of natural selection.
   Even though Darwin had developed and written a summary of his natural selection theory, he hesitated to publish it. Part of this was because of the controversy this posed. His ideas countered religious convictions of the time and would have been met with a lot of resistance. He was not ready to be the center of an argument between science and religion, and so he waited more than two decades to finally publish his theory on natural selection. 


resources: 
Berkeley on Darwin
Thomas Malfus 
Influences on Darwin 
Religion vs Science, Darwin's Hesitation
Introduction to Physical Anthropology 2013-2014(text book)